International Journal of Philippine Science and Technology ( formerly Philippine Science Letters )

 




Posted on in the International Journal of Philippine Science and Technology 2015 Volume 8 Issue Number 2 Page 1923

*Corresponding Author
Email Address: asbulasag@up.edu.ph
Submitted: March 24, 2015
Revised: May 14, 2015
Accepted: May 19, 2015
Published: July 15, 2015



SHORT COMMUNICATION

Development of microsatellite markers for genetic diversity analysis in Glossogobius giuris (Hamilton, 1822) and Rhinogobius giurinus (Rutter, 1897)

by *1, 2, 2, and 2

1UP Rural High School, UP Los Baños, College, Laguna
2Institute of Biological Sciences, UP Los Baños, College, Laguna

Abstract—Microsatellite-enriched libraries were constructed from Glossogobius giuris and Rhinogobius giurinus. BLAST analysis revealed significant homology of the clones with microsatellite-rich regions in other teleosts and other members of Gobiidae. Eight microsatellite primers were designed and tested for cross-amplification in two other goby species, Glossogobius celebius and Gobiopterus lacustris. Four primer pairs amplified putative microsatellite loci in all four species. Four other primer pairs amplified loci in at least two species. Primer Rh18 was the most informative and exhibited the greatest number of polymorphic alleles (PIC=0.7262; Na=7). Two other primers, Rh51 and Gi47 were also informative markers with PIC values ≥ 0.5. Using five primers, both G. giuris and R. giurinus samples exhibited moderately high values of genetic diversity based on the number of alleles (~5), percent polymorphism (53%), and observed (61%) and expected (58%) heterozygosities.

Keywords—microsatellites, genetic diversity, subtractive hybridization, Glossogobius giuris Hamilton, Rhinogobius giurinus Rutter, Gobiidae



INTRODUCTION

Family Gobiidae is one of the largest fish families, with approximately 2,000 species and 200 genera (Froese & Pauly, 2008). Though only few species are commercially important, they play a very important role as prey species for commercially important fishes like sea bass. Some gobies have potential as aquarium fishes. They may be keystone species (having disproportionate importance) in freshwater environments in small oceanic islands because of their prevalence in these habitats (Allen & Robertson, 1994; Helfman et al., 1997).

The diversity in form is a hint of the tremendous genetic variability that exists within the family. Most gobies are adapted to marine environments and are abundant in brackish water and estuarines (lower reaches of rivers, mangrove swamps, and salt marshes). Of 315 Philippine freshwater goby species listed in FishBase, 70 are native, while 16 can only be found in the Philippines (Froese & Pauly, 2010). These figures further present the significance of gobies in Philippine ecosystems. Despite this, there is a dearth of researches about their nature of diversity, genetics and population genetic structure. These parameters are very important in understanding population dynamics, ecology, as well as for conservation studies.

Protection of biodiversity is anticipated to be both crucial and ongoing in the 21st century (Oliveira et al., 2006). Conservation genetics has been given primary importance for avoiding extinction of endangered species alongside the political, economic and ecological aspects of biodiversity protection. With the advent of molecular approaches, the examination of the genetics of species in danger of extinction proves to be a useful tool in conservation research. The impact on genetic diversity is quite critical, as genetic variation is needed for species adaptation and taxa speciation (Hughes et al., 1997). DNA analyses promote increased knowledge on the genetic structure of fish species and their response to environmental changes (Piorski et al., 2008). Several molecular tools have been used to assess genetic variation (Strecker et al., 2003; Barroso et al., 2005), determine population genetic structure (Hatanaka & Galetti, 2003; Spruell et al., 2003) and gene flow among animal species (Mallet, 2005). Traditional molecular markers have, in general, provided insufficient statistical power and accuracy for estimating genetic differences (Oliveira et al., 2006). However, with the discovery of highly variable loci such as microsatellites or simple sequence repeats (SSRs), the statistical power for determining differentiation between species groups at risk of extinction is now usually very high (Hedrick, 2001).

Microsatellite markers are dubbed as the most versatile molecular markers with various applications in population genetics, conservation biology, and evolutionary biology (Abdul-Muneer, 2014). Microsatellite data sets are important starting points for studies involving parentage analysis, proper identification, and phylogeographic studies. They provide answers to genetic questions that were previously viewed as dead blocks and present insights as to how genetic variation is partitioned among populations, giving reliable estimates of population differentiation that are crucial to understand the connectivity among populations and represent important tools to develop conservation strategies (Balloux & Moulin, 2002). They are the most preferred PCR-based tool for fish population genetic studies (Beckman & Soller, 1990; Shabani et al., 2013) and have been identified as robust and valuable tools in fish genetics (Wright & Benzen, 1994). In the absence of full genome sequences, the most preferred technique is to produce highly enriched microsatellite libraries first described by Edwards et al. (1996). In addition, cross-amplification among related taxa has been found to be commonplace especially among several fish species (Leclerc et al., 2000; Cairney et al., 2000; Vyskocilova et al., 2007).

This study isolated, characterized, and developed microsatellite primers from Glossogobius giuris and Rhinogobius giurinus, two goby species that are abundant in the Southern Tagalog, Philippines. The developed primers were used for cross species amplification and genetic diversity analysis.



Figure 1. Fish specimens used in the study: A. Glossogobius celebius (Valenciennes, 1837); B. Glossogobius giuris (Hamilton, 1822); C. Rhinogobius giurinus (Rutter, 1897); D. Gobiopterus lacustris (Herre, 1927) (Photograph by Labatos, 2013).



MATERIALS AND METHODS
Samples and DNA Extraction

R. giurinus and G. giuris fish samples were collected from the UPLB Limnological Station and Dampalit River in Los Baños, Laguna and Lake Ticob in Quezon Province. DNA used in library construction was isolated from pooled fish fin samples using DNeasy Blood and Tissue Kit (Qiagen, Germany). For species cross-amplification, two other species were collected (Gobiopterus lacustris and G. celebius) (Figure 1) and their DNA extracted. For assessment of genetic diversity, thirty-three (33) R. giurinus and thirty (30) G. giuris individuals were collected. DNA extraction was done from fins and muscles following a standard phenol-chloroform extraction protocol (Wasko et al., 2003). DNA quality and quantity were checked using electrophoretic and spectrophotometric (Nanodrop®) techniques.

Microsatellite Enrichment and Library Screening

RsaI-digested genomic DNA (approx. 10μg) was ligated with 20 μM oligonucleotide linkers (Linker1: 5’- GTTTAGCCTTGTAGCAGAAGC -3’, Linker2: 5’- p GCTTCTGCTACAAGGCTAAACAAAA-3’) using supplier prescribed conditions (Invitrogen, USA). PCR was performed using primers specific for the linkers. To confirm ligation of linkers to the genomic DNA, PCR was performed in a volume of 20 μL containing 2 μL ligated DNA, 2 μL 10x PCR buffer, 1.6 μL dNTPs (10mM), 1.6 μL of linker (Rsa 21), 0.5 U of Taq polymerase in a thermal cycler as follows: 1 cycle for 5 min at 94°C, 30 cycles for 30 sec at 94°C, 1 min at 600C, 1 min at 72°C, and final extension for 7 min at 72°C. Ligation was indicated by the observed smearing at 300-1500 bp in agarose gel (100V for 2 hours). A microsatellite enrichment protocol developed by Glenn & Schable (2005) was used to fish out SSR-rich regions in the genomes of G. giuris and Rhinogobius giurinus through subtractive hybridization. Repeat-enriched genomic DNA was amplified in 50 μL reaction containing 10 μL repeat-enriched DNA, 5 μL 10x PCR Buffer S (Vivantis, Malaysia), 4 μL dNTPs (10 mM), 4 μL of Rsa21 (10 μM), 0.3 μL of Taq pol (5U/μL), and 26.7 μL sterile distilled water was placed in a thermal cycler as follows: 1 cycle for 5 min at 94°C, 30 cycles for 30 sec at 940C, 1 min at 60°C, 1 min at 68°C, and a final extension for 7 min at 68°C. To avoid high redundancy in the library, the PCR reaction was performed with 20 to 25 cycles. The microsatellite PCR products were cleaned using Qiaquick Purification Kit (Qiagen, Germany). The purified PCR product was ligated to pGEM T-Easy Vector (Promega, USA) and transformed into E. coli JM109 competent cells (Promega, USA) according to manufacturer’s specifications. Isolated plasmids from 17 different transformants for each species were sent to Macrogen, Inc. (Korea) for sequencing.

Microsatellite Primer Design

The quality of sequences were first analyzed using ChromasPro 2.1 software (Technelysium Pty Ltd, Tewantin QLD, Australia). The presence of specific SSR repeat motifs were analyzed using Microsatellite Finder program, available online (http://biophp.org/minitools/microsatellite_repeats_finder/demo.php). Eight primer pairs were designed using Primer3-BLAST Software Package (Rozen & Staletsky, 2000). The primers were sent to Invitrogen for synthesis. Table 1 shows the designed primers including standard parameters.


Table 1. Characteristics of eight (8) SSR primer pairs based on microsatellite-enriched libraries of Glossogobius giuris and Rhinogobius giurinus used in species cross-amplification and genetic diversity analysis.


Genetic Diversity Assessment and Primer Data Analysis

PCR profile for touchdown protocol was used to enhance the success of the amplifications based on Ghiasi et al. (2009) with minor variations in melting and annealing temperatures. The touchdown PCR profile consists of the following steps: initial denaturation at 94°C for 5 min; 20 cycles of 94°C denaturation for 30 sec, annealing with 0.5°C decrement in temperature every cycle (a 10°C range) for 45 sec, and extension at 72°C for 2 min; a final extension at 72°C for 5 min. Polyacrylamide Gel Elecrophoresis (PAGE) was then used to genotype PCR profiles of the G. giuris and R. giurinus. Polymorphism Information Content (PIC), a measure of polymorphism for a marker locus used in linkage analysis, was computed for each of the primers used, as well as other parameters like: number of alleles, allele size range, expected product size, number of polymorphic alleles, and observed (Ho) and expected (He) heterozygosities. Parameters were computed using Powermarker Version 3.0 devised by Jack Liu from North Carolina State University.


RESULTS AND DISCUSSION
Isolated Microsatellite Loci and Species Cross-amplification

Seventeen sequences (100%) from G. giuris and 14 of 17 (82.4%) from Rhinogobius giurinus contained microsatellites. There were more GA/CT clones (58.8%) than CA/GT ( 41.2%) clones despite previous reports (Stallings et al., 1991) stating CA/GT repeats are more common among animals. Since only a fraction of the total library clones were screened, there is still a possibility that the other clones contain different motifs.

Almost all sequences had BLAST hits with microsatellites from the model zebrafish (Danio rerio) genome, with maximum identity of ≥75% (Table 2). There were also a great number of BLAST hits with microsatellite sequences from carp (Cyprinus carpio) and other teleosts such as perch (Perca schrenkii), salmon (Salmo salar), and Chinese perch (Siniperca chuatsi). These suggest the robustness of the procedure employed in selecting microsatellite-containing DNA fragments and microsatellites’ ubiquity among teleosts. Rico et al. (1996) provided evidence that sequence homology of the flanking regions of microsatellites are quite conserved in fishes and that this might be due to the low rate of base substitution observed in aquatic organisms compared to terrestrial animals. This was further corroborated by the observations on the family Cyprinidae by Zardoya et al. (1996).


Table 2. BLAST hits of the different microsatellite sequences from different teleosts in the NCBI GenBank.


The eight primer pairs successfully amplified the microsatellite-containing loci in the DNA samples from four species (G. celebius, G. giuris, Gobiopterus lacustris, and Rhinogobius giurinus). In some interspecies amplifications, PCR products were not uniform in size, suggesting variation in the number of tandem repeats in the DNA template.

Results from cross-amplification implies that there is diversity in the characteristic length of allelic forms of microsatellite loci. Table 3 summarizes the results of cross-amplification across the species. Inter-specific cross-amplification of DNA segments may provide a more cost-effective approach in population genetics. Cross-species amplification, which was evident in this study, is an indication that the primer sequences used are greatly conserved across the family as suggested by Moore et al. (1991) and Peakall et al. (1998) and that they may be quite useful in investigating other goby species’ population genetic structure.


Table 3. Cross-amplification of microsatellite-containing loci across four species of Family Gobiidae.


Half of the primers (Gi47, Rh23, Rh4, and Rh18) were successful in amplifying DNA fragments across all four species used. This suggests that these primer sequences are effectively conserved across the four species. Two primer pairs (Rh51 and Gi51) amplified DNA fragments in three out of four species.

While two other primer pairs (Rh37 and Gi21) were successful in amplifying DNA fragments for two out of four species. Gi21, on the other hand, amplified DNA fragments only for the two Glossogobius species. As expected, all eight primers amplified microsatellite DNA of the respective source organisms, G. giuris and R. giurinus. The primers were effective in amplifying not only the source DNA but also DNA from close relatives. This is in support of previous studies on the effectiveness of heterologous primers across species in the same family (Larmuseau et al., 2007; Lin et al., 2007; Yaraguntappa et al., 2007).


Genetic Diversity Assessment

Table 4 summarizes the result of the diversity analysis on G. giuris based on five microsatellite loci. Amplification with primers Gi51 and Gi47 exhibited SSR loci with lowest numbers of alleles observed (Na=2) and correspondingly had lowest PIC values (0.0905 and 0.3610, respectively). These two were the least informative or not at all informative among the five primers used. In contrast, Rh18, which produced seven polymorphic alleles, had the highest PIC value of 0.7981. Two primers, Rh18 and Rh51 are considerably informative (PIC≥0.5) markers for the G. giuris population. Deviations from expected heterozygosities may indicate important population dynamics. Based on this premise, three markers (Rh18, Gi47, and Rh51) provide promising insight into the diversity that exist within the G. giuris population. The mean observed heterozygosity approximates the value of the expected heterozygosity. Moreover, heterozygosity values are greater than 0.5 suggesting a high value of genetic diversity. For the loci considered, genetic diversity is quite evident in the G. giuris population.


Table 4. Genetic diversity analysis of Glossogobius giuris population using the following parameters: number of alleles (Na), allele size range, no. of polymorphic alleles, polymporphism information content (PIC), and observed (Ho) and expected (He) heterozygosities.


Table 5 summarizes the results for the genetic diversity analysis on R. giurinus. Number of alleles ranged from two to five. Rh51 was the most informative marker (PIC=0.6987), followed by Gi47 (PIC=0.6345). Rh23 and Gi51 were the least informative having PIC values lower than 0.4. This may be in part due to the low number of polymorphic alleles observed in Rhinogobius population using these two markers. However mean PIC still approximates the value 0.5, which means the markers are still informative and hence may be used in diversity studies. Mean observed heterozygosity is slightly higher than expected and may be attributed to inherent variability of the population. A high level of average heterozygosity in terms of the observed heterozygosity is expected to correlate with high genetic variation at loci which are important for adaptive response to environmental stresses (Kotze & Muller, 1994; Lieutenant-Gosselin & Bernatchez, 2006). Hence, this would strengthen the effectivity of the markers developed for future genetic diversity studies not only of important freshwater goby species but of other important endemic and native freshwater species.


Table 5. Genetic diversity analysis of Rhinogobius giurinus population using the following parameters: number of alleles (Na), allele size range, no. of polymorphic alleles, polymporphism information content (PIC), and observed (Ho) and expected (He) heterozygosities.


CONCLUSION

Microsatellite loci can be effectively isolated from Philippine freshwater fish species through microsatellite-enrichment protocols. SSR primers can be designed and utilized in future investigations on genetic diversity of native and endemic Philippine freshwater goby species. They can also be potentially utilized for other applications such as studies on parentage analysis, phylogenetic relationships, breeding, and others.


ACKNOWLEDGEMENTS

The authors would like to thank Dr. Pablo P. Ocampo of the UPLB Limnological Station, the program leader of the Fish Ark Program which provides direction for the conservation of endemic and native Philippine freshwater fishes, and DOST-PCAMRD, for funding the research.


CONFLICT OF INTEREST

The authors report no conflict of interest.


CONTRIBUTIONS OF INDIVIDUAL AUTHORS

ASB drafted the manuscript. ASB, ASP and NTDA conducted all experiments. ASB and ASP participated in the field collection of the fish specimens. MGQD conceptualized the research and helped write the manuscript.


REFERENCES
  • Abdul-Muneer, PM. (2014). Application of Microsatellite Markers in Conservation Genetics and Fisheries Management: Recent Advances in Population Structure Analysis and Conservation Strategies. Genetics Research International Volume 2014 (2014), Article ID 691759, 11 pages http://dx.doi.org/10.1155/2014/691759
  • Allen G, Robertson D. (1994). Fishes of the Tropical Eastern Pacific. Honolulu, HI: University of Hawaii Press
  • Balloux F, Lugon-Loulin F. (2002). The estimation of population differentiation with microsatellite markers. Molecular Ecology 11, 155–165
  • Barroso, RM, Hilsdorf AWS, Moreira HLM, Cabello PH, and Traubcseko YM. (2005). Genetic diversity of wild and cultured populations of Brycon opalinus (Cuvier, 1819) (Characiforme, Characidae, Bryconiae) using microsatellites. Aquaculture 247(1-4): 51-65
  • Beckmann, JS and Soller, M. (1990). Toward a unified approach to genetic mapping of eukaryotes based on sequence tagged microsatellite sites. Bio/Technology 8:930– 932
  • Cairney M, Taggart JB, Hoyheim, B. (2000). Characterization of microsatellite and minisatellite loci in Atlantic salmon (Salmo salar L.) and cross-species amplification in other salmonids. Mol. Ecol. 9:2175–2178
  • Edwards KJ, Barker JHA, Daly A, Jones C, and Karp A. (1996). Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques 20: 758–760
  • Froese R, Pauly D (eds). (2008). FishBase World Wide Web Electronic Publication. www.fishbase.org.version(04/2008)
  • Froese R, Pauly D. (2010). List of Freshwater Fishes for Philippines, summarized from FishBase country checklist freshwater fishes. world wide web electronic publication. www.fishbase.org, version (11/2010)
  • Ghiasi N, Rashid ZA, Hooshmand S, Yusoff K, Tan SG, Bhassu S. (2009). The Use of Locus Specific Microsatellite Markers for Detecting Genetic Variation in Hatchery bred Probarbus jullienii. Biotechnology 8: 166-170
  • Glenn TC, Schable M. (2002). Microsatellite Isolation with Dynabeads. Unpublished manual. Savannah River Ecology Laboratory, Aiken, South Carolina
  • Hatanaka T and Galetti JR. (2003). RAPD markers indicate the occurrence of structured populations in a migratory freshwater fish species. Genet. Mol. Biol. 26(1): 19-25
  • Hedrick W. (2001). Conservation genetics: Where are we now? Trends in Ecology and Evolution 16:629-636
  • Helfman G, Collete D, and Facey D. (1997). The Diversity of Fishes. Malden, MA: Blackwell
  • Hughes JB, Daily GC and Ehrlich PR. (1997). Population diversity: its extent and extinction. Science 278(5338): 689-694
  • Kotzé A. and Muller, G.H. 1994. Genetic relationship in South African cattle breeds. In: Proceedings of the 5th world congress on genetics applied to livestock production, Guelph, Canada. University of Guelph, Guelph, Ontario, Canada. Volume 21: 413–416.
  • Labatos, BVJ and Briones, ND. (2014). Freshwater Fishes of Tikub Lake, Tiaong, Quezon, Philippines. Asian Journal of Biodiversity 5:41-53
  • Larmuseau MHD, Hellemans B, Van Houdt JKJ, and Volcakaert FAM. (2007). Development and characterization of nine polymorphic microsatellite markers in the sand goby Pomatoschistus minutus (Gobiidae). Molecular Ecology Notes 7(1): 147–149
  • Leclerc D, Wirth T, Bernatchez L. (2000). Isolation and Characterization of Microsatellite Loci in the Yellow Perch (Perca flavescens) and Cross-species Amplification within the Family Percidae. Mol. Ecol. 9:995-997
  • Lieutenant-Gosselin, M and Bernatchez, L. (2006). Local Heterozygosity-Fitness Correlations with Global Positive Effects on Fitness in Threespine Stickleback. Evolution 60(8): 1658-1668
  • Lin CJ, Wang JP, Lin HD, and Chiang TY. (2007). Isolation and characterization of polymorphic microsatellite loci in Hemibarbus labeo (Cyprinidae) using PCR-based isolation of microsatellite arrays (PIMA). Molecular Ecology Notes 7(5): 788–790
  • Mallet J. (2005). Hybridization as an invasion of the genome. Trends Ecol. Evol 20:229–237. doi:10.1016/j.tree.2005.02.010
  • Moore SS., Sargeant LL, King TJ, Mattick JS, Georges M, Hetzel DJ. (1991). The Conservation of dinucleotide microsatellites among mammalian genomes allows the use of heterologous PCR primer pairs in closely related species. Genomics 10 (3):654-660
  • Oliveira EJ, Padua JG, Zucchi MI, Vencovsky R and Vieira MLC. (2006). Origin, evolution and genome distribution of microsatellites. Genetics and Molecular Biology 29(2): 294-307
  • Peakall R, Gilmore S, Keys W, Morgante M, Rafalski (1998). A. Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. MolBiolEvol 15(10):1275-1287
  • Piorski NM, Garavello JC, Arce H, and Perez MHS. (2008). Platydoras brachylecis, a new species of thorny catfish (Siluriformes: Doradidae) from northeastern Brazil. Neotrop. Ichthyol. 6(3): 481-494
  • Promega. (2007). pGEM Tand pGEM T-Easy Vector Systems Technical Manual Instructions for Use of Products A1360, A1380, A3600 and A3610 Part # TM042. Printed in USA, Revised 5/07
  • Rico C, Rico I, Hewitt G. (1996). 470 Million Years of Conservation of Microsatellite Loci among Fish Species. Proceedings: Biological Sciences 263 (1370): 549-557
  • Rozen S, Skaletsky H. (2000). Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386
  • Shabani A, Askari G, and Moradi A. (2013). Genetic variation of Garra rufa fish in Kermanshah and Bushehr provinces, Iran, using SSR microsatellite markers. Molecular Biology Research Communications 2(3): 81-88
  • Spruell P, Hemmingsen AR, Howell PJ, Kandal N, and Allendorf FW. (2003). Conservation genetics of bull trout: geographic distribution of variation at microsatellite loci. Conserv. Genet. 4(1): 17-29
  • Stallings AF, Nelson D, Torney DC, Hildebrand CE, and Moyzis RK. (1991). Evolution and distribution of (GT)n repetitive sequences in mammalian genomes. Genomics 10: 807-815
  • Strecker U, Bernatchez L, and Wilkens H. (2003). Genetic divergence between cave and surface populations of Astyanax in Mexico (Characidae, Teleostei). Mol. Ecol., 12(3): 699-710
  • Tozaki T, Mashima S, Hirota K, Miura N, Choi-Miura N, Tomita M. (2001). Characterization of Equine Microsatellites and Microsatellite Linked Repetitive Elements (eMLREs) by Efficient Cloning and Genotyping Methods. DNA Research 8:33–45
  • Vyskocilova M, Ondrackova M, Šimkova A, and Martin JF. (2007). Isolation and characterization of microsatellites in Neogobius kessleri (Perciformes, Gobiidae) and cross-species amplification within the family Gobiidae. Molecular Ecology Notes 7: 701–704
  • Wasko AP, Martins M, Oliveira C, and Foresti F. (2003). Non-destructive Genetic Sampling in Fish. An improved Method for DNA samples in fish fins and scales. Hereditas 138(3):161-165
  • Wright JM, Benzen P. (1994). Microsatellites: genetic markers for the future. In: Reviews in Fish Biology and Fisheries (eds Carvalho GR, Pitcher TJ), pp. 384–388. Chapman & Hall, London
  • Yap IV, Nelson RJ. (1996). WinBoot: UPGMA bootstrapping for binary data. IRRI Discussion Paper, Series No. 14, pp. 1-20 Yaraguntappa B, Prasad DT, Rani K, Kumar KP, Naika UD, Jahageerdar S, PrakashSrivastava P, Penman DJ, Mair GC. (2007). Genetic diversity in common carp stocks assayed by random-amplified polymorphic DNA markers Aquaculture Research 38(2): 147–155 doi:10.1111/j.1365-2109.2006.01639.x
  • Zardoya R, Vollmer DM, Craddock C, Streelman JT, Karl S, and Meyer A. (1996). Evolutionary Conservation of Microsatellite Flanking Regions and their Use in Resolving the Phylogeny of Cichlid Fishes (Pisces:Perciformes). Proceedings: Biological Sciences 263 (1376): 1589-1598







Announcements

STRIDE Grants The next call for Grants will commence on February 27, 2015. To know more about the Grants program of STRIDE, you may visit our website at stride.org.ph.